CRISPR edit: BCL11A enhancer / HEK293T / Cas9 RNP

{
    "experiment": {
        "id": 314,
        "custom_id": "CR-BCL11A-2026-019",
        "title": "CRISPR edit: BCL11A enhancer / HEK293T / Cas9 RNP",
        "template": "CRISPR Cas9 Editing",
        "template_version": "v3.2",
        "category": "Molecular Biology",
        "status": "Complete",
        "started_on": "2026-07-20",
        "tags": [
            "CRISPR",
            "Cas9-RNP",
            "BCL11A",
            "gene-editing",
            "sgRNA"
        ]
    },
    "main_text": "This template captures CRISPR/Cas9 RNP-mediated editing of the BCL11A erythroid enhancer in HEK293T cells, a well-validated target for proof-of-concept editing experiments and HbF reactivation research.\nGoal: achieve ≥60% editing efficiency at the BCL11A +58 GATA1 binding site in HEK293T cells via Cas9 RNP electroporation, with verification by T7E1 mismatch assay and ICE-Sanger indel deconvolution.\nMethod overview: Synthetic sgRNA (Synthego or IDT, 100 nmol scale, 5′-modified for stability) targeting BCL11A +58 enhancer is complexed with 5 µg recombinant SpCas9 protein (Aldevron or IDT HiFi v3) at room temperature for 20 minutes in PBS. 200,000 HEK293T cells per condition are nucleofected using Lonza 4D-Nucleofector SF reagent (program CM-130). Cells are plated in 24-well format, harvested at 72 hours post-nucleofection. Genomic DNA extracted (Qiagen DNeasy), 500 bp amplicon spanning the cut site PCR-amplified, T7E1 cleavage assay run on agarose, and amplicon Sanger-sequenced for ICE analysis.\nExpected: 60-75% editing efficiency in the bulk population (T7E1 cleavage 30-45% scaled to ICE). Indel spectrum dominated by +1 insertion, −1 deletion, and small (1-7 bp) deletions. Single-cell clones (4-6 picked) typically yield 50-70% homozygous knockout. No off-target effects at top-3 predicted sites by GUIDE-seq.",
    "extra_fields": {
        "Target": {
            "Target gene": {
                "type": "text",
                "value": "BCL11A (+58 erythroid enhancer)"
            },
            "sgRNA name": {
                "type": "text",
                "value": "sg-BCL11A-58-3"
            },
            "sgRNA sequence": {
                "type": "text",
                "value": "CTAACAGTTGCTTTTATCAC 20 nt"
            },
            "PAM": {
                "type": "text",
                "value": "AGG"
            }
        },
        "Guide & Delivery": {
            "Cell line": {
                "type": "select",
                "value": "HEK293T, K562, U2OS, iPSC, primary T"
            },
            "Delivery method": {
                "type": "select",
                "value": "electroporation, lipofection, viral transduction"
            },
            "Cas9 source": {
                "type": "select",
                "value": "SpCas9 WT, HiFi Cas9, dCas9, BE3, BE4-max, PE2"
            },
            "EP program": {
                "type": "text",
                "value": "Lonza 4D-Nucleofector · SF · CM-130"
            }
        },
        "Verification": {
            "Editing efficiency": {
                "type": "number",
                "value": "65 % (ICE)"
            },
            "T7E1 cleavage": {
                "type": "number",
                "value": "38 %"
            },
            "Dominant indel": {
                "type": "text",
                "value": "+1 insertion (22%) · -1 deletion (18%)"
            },
            "Clones genotyped": {
                "type": "text",
                "value": "4 / 6 homozygous KO"
            }
        }
    },
    "attached_files": [
        {
            "filename": "sgRNA_design.pdf",
            "type": "pdf",
            "size": "292 KB"
        },
        {
            "filename": "T7E1_gel.tif",
            "type": "png",
            "size": "2.1 MB"
        },
        {
            "filename": "sanger_ICE_traces.zip",
            "type": "docx",
            "size": "4.8 MB"
        }
    ],
    "steps": [
        {
            "n": 1,
            "description": "Design sgRNA targeting BCL11A +58 enhancer using CRISPick + manual off-target check",
            "duration": "0:45",
            "complete": true,
            "note": "Top score; 0 off-targets with ≤2 mismatches in coding"
        },
        {
            "n": 2,
            "description": "Order synthetic sgRNA (Synthego, 100 nmol, 5' chemically modified)",
            "duration": "0:05",
            "complete": true,
            "note": "Lot CR2026-014 received 2026-06-01"
        },
        {
            "n": 3,
            "description": "Resuspend sgRNA to 100 µM in nuclease-free TE, aliquot 10 µL × -80 °C",
            "duration": "0:10",
            "complete": true
        },
        {
            "n": 4,
            "description": "Pre-complex: 5 µg Cas9 + 100 pmol sgRNA in 5 µL PBS, RT 20 min",
            "duration": "0:22",
            "complete": true
        },
        {
            "n": 5,
            "description": "Trypsinize HEK293T, count, resuspend 2×10⁵ cells/condition in 20 µL SF reagent",
            "duration": "0:20",
            "complete": true
        },
        {
            "n": 6,
            "description": "Mix cells + RNP, nucleofect Lonza 4D-Nucleofector program CM-130",
            "duration": "0:10",
            "complete": true,
            "note": "Run 06:04:11:42"
        },
        {
            "n": 7,
            "description": "Plate cells in 24-well + pre-warmed DMEM/10% FBS, return to 37°C incubator",
            "duration": "0:08",
            "complete": true
        },
        {
            "n": 8,
            "description": "Harvest cells at 72 h, extract gDNA (Qiagen DNeasy), elute 50 µL",
            "duration": "1:30",
            "complete": true,
            "note": "Concentration 142 ng/µL · A₂₆₀/A₂₈₀ 1.92"
        },
        {
            "n": 9,
            "description": "PCR amplify 500 bp locus across cut site; run T7E1 mismatch on portion",
            "duration": "2:30",
            "complete": true,
            "note": "T7E1 38% cleavage"
        },
        {
            "n": 10,
            "description": "Sanger sequence amplicon (Eurofins), upload to ICE for indel deconvolution",
            "duration": "24:00",
            "complete": true,
            "note": "ICE 65% efficiency · KO score 0.61"
        }
    ],
    "spreadsheet": [
        [
            "Indel",
            "Frequency (%)",
            "Reads",
            "Notes"
        ],
        [
            "WT (no edit)",
            "35",
            "352",
            "unedited allele"
        ],
        [
            "+1 ins (A)",
            "22",
            "218",
            "most frequent edit"
        ],
        [
            "-1 del (T)",
            "18",
            "181",
            "second most frequent"
        ],
        [
            "-2 del",
            "10",
            "101",
            ""
        ],
        [
            "-5 del",
            "8",
            "79",
            "in-frame disruption"
        ],
        [
            "-7 del",
            "4",
            "42",
            ""
        ],
        [
            "other",
            "3",
            "27",
            "larger indels / complex"
        ]
    ],
    "links": {
        "experiments": [
            {
                "ref_id": "EXP-2026-0521",
                "title": "sgRNA design + off-target screen (CRISPick)",
                "owner": "S. Khan",
                "date": "May 21"
            },
            {
                "ref_id": "EXP-2026-0608",
                "title": "Single-cell clone picking + genotype",
                "owner": "S. Khan",
                "date": "Jun 8"
            }
        ],
        "resources": [
            {
                "ref_id": "SOP-0412",
                "title": "CRISPR Cas9 RNP SOP v2.0",
                "owner": "QA Team",
                "date": "Apr 12"
            },
            {
                "ref_id": "IBC-2026",
                "title": "IBC approval — BCL11A editing protocol",
                "owner": "Biosafety Office",
                "date": "Mar 14"
            },
            {
                "ref_id": "TOOL-ICE",
                "title": "Synthego ICE Sanger deconvolution tool",
                "owner": "External Tools",
                "date": "Jan 28"
            }
        ]
    },
    "compounds": [
        {
            "name": "SpCas9 protein (Aldevron, 10 µg/µL)",
            "catalog_lot": "#9212-0250 · Lot 2562194",
            "stock_status": "In stock"
        },
        {
            "name": "sg-BCL11A-58-3 synthetic sgRNA (100 nmol)",
            "catalog_lot": "Synthego CR2026-014",
            "stock_status": "In stock"
        },
        {
            "name": "SF Cell Line Nucleofector kit",
            "catalog_lot": "V4XC-2024 · Lot 3621842",
            "stock_status": "In stock"
        },
        {
            "name": "T7 Endonuclease I (T7E1)",
            "catalog_lot": "M0302S · Lot 10174612",
            "stock_status": "In stock"
        },
        {
            "name": "Q5 High-Fidelity 2× Master Mix",
            "catalog_lot": "M0492 · Lot 10174924",
            "stock_status": "In stock"
        },
        {
            "name": "Qiagen DNeasy Blood & Tissue Kit",
            "catalog_lot": "69504 · Lot 172421842",
            "stock_status": "Low"
        }
    ],
    "storage": [
        {
            "name": "Cas9 protein aliquots (5 µg working)",
            "location": "-80 °C · Freezer A-3 · Drawer 4 · Box CR-CAS9-2026",
            "count": "×8"
        },
        {
            "name": "sgRNA stock + working dilutions",
            "location": "-80 °C · Freezer A-3 · Drawer 4 · Box CR-SG-2026",
            "count": "×6"
        },
        {
            "name": "Edited cell clones (frozen working stocks)",
            "location": "-80 °C · Freezer A-2 · Rack 6 · Box BCL11A-CLO",
            "count": "×4"
        }
    ],
    "permissions": {
        "visibility": [
            {
                "type": "Team",
                "name": "Khan Lab"
            },
            {
                "type": "Person",
                "name": "S. Khan"
            }
        ],
        "can_write": [
            {
                "type": "Person",
                "name": "S. Khan"
            },
            {
                "type": "Person",
                "name": "Dr. P. Joshi"
            }
        ]
    }
}